Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D085G06
Clone ID D085G06
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD085G06
Sequence
GATCCACGGCCCTGGCTCCTGCAAGCTCTTTGGCTTCATCTTCTACAGCAACATCTACATCAGCATCGCCTTCCTGTGCT
GCATCTCCGTGGACCGCTACCTGGCTGTGGCTCATCCTCTGCGCTTTGCACGCCTGCGCCGGGTCAAGACAGCAGTGGCT
GTGAGCTTTGTGGTCTGGGCCACGGAGCTGGGCGCCAATTCAGCACCGCTCTTCCATGATGAGCTGTTTCGTGATCGCTA
CAACCACACCTTCTGCTTTGAGAAGTTCCCCATGGAGCGTTGGGTGGCCTGGATGAATCTGTACCGCGTCTTTGTGGGCT
TCCTCTTCCCCTGGGCACTCATGTTGCTGTGCTACCGTGGCATCCTGAGNNNCTGTGANNANNCAGTGTGTCCTCCAGNN
GCCAGGAGAAAGTCAAGATCAAA
Sequence Type genomic DNA
Unitrap ID UNI21652

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 19807758..19808178 387
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044317 (Gpr4) NM_175668 G protein-coupled receptor 4 Gene [Source:MGI Symbol;Acc:MGI:2441992]


SPLK-Sequence tag 3SD085G06
Sequence
TGCCCGCAGTGATGTGGCCAAGGCCCTGCACAACCTCCTCCGCTTCCTGGCCAGCAACAAGCCCCAGGAGATGGCCAATG
CTTCCCTCACCCTGGAGACACCCTTGACCTCCAAGAGGAGCACCACTGGCAAGTCGTCCGGAGCTGTCTGGGCAGTGCCT
CCGACTGCCCAGGGGGACCAGGTGCCACTGAAGGTGCTGCTGCCCCCGGCACAGTGAGCCCCATGCCCAACTGTCATCCT
GCACCCTTCCNNNTGTATGCAAATGTGTGTAAATATGTCCATGTGAATTACAAGAAAAAAATGANNNTTTTTTTTGTCTC
TCTGTCATCTTCTTCCACTATGATCCCCAATGATTCACTTAATCCCAGCAGGGTCTGAAGGGGGAACAACACAGCCAGGA
GTTTGTCATCATGGGCGCCCAGATNGGGAGCCAGCCATGGAGAGTTTGGGATGAGGGGATAATTAAGCCAACTG
Sequence Type genomic DNA
Unitrap ID UNI21652

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 19808385..19808857 452
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044317 (Gpr4) NM_175668 G protein-coupled receptor 4 Gene [Source:MGI Symbol;Acc:MGI:2441992]

 
Come back to gene ENSMUSG00000044317


For any suggestions or comments, please send an email to unitrap@crg.es