Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D085E07
Clone ID D085E07
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD085E07
Sequence
GACCTAGGAGAGCCAGTCTTGAGACTGCTGGACACCAGGAGGTGAAAGGGCCAGGCTCTCTGAGAGATTGTACAGCCTTC
ACCTTCTCAGAGTA
Sequence Type genomic DNA
Unitrap ID UNI30190

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 93867409..93867502 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039456 (Morc3) NP_001038994 microrchidia 3 Gene [Source:MGI Symbol;Acc:MGI:2136841]

 
Come back to gene ENSMUSG00000039456


For any suggestions or comments, please send an email to unitrap@crg.es