Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D085C04
Clone ID D085C04
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD085C04
Sequence
ACTAACCTCAGGAGCAGNNNGTGACTTCCTCTTTCCAATTAGGAACCTGAAGAGTGCCACATGCCTTAGTAATGAGCATC
GGCAGTGCCCTGAAGCTTCAGGAGACTTCCAGCCAAATAGAGCATCTGAAACTTTGTCATGGCTCTCCTGGGTGAATGGG
CATTGTCTTGATTCACACGCTCTATGTGAAAGGG
Sequence Type genomic DNA
Unitrap ID UNI30191

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11663256..11663450 181
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018654 (Ikzf1) NM_009578 IKAROS family zinc finger 1 Gene [Source:MGI (curated);Acc:Ikzf1-003]

 
Come back to gene ENSMUSG00000018654


For any suggestions or comments, please send an email to unitrap@crg.es