Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D085A07
Clone ID D085A07
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD085A07
Sequence
CCCTCGATGACCTGGAGNGCAACCAGAGCAGACGGGAACCCTAGAGGTCCCAGTTGCTCAGGGAATGCCAGAGGCACCGG
AGCAAGATGAGGACAGAGCCCAAGCAGGTGAACAAGACTCCGTAGAGGTGACCCTTGGGTTAGAGGCTGCCAGAGCTGGA
CTGGAACTCGAGCAGGAAGTGGTAGGGCTAGAGGNNCCAAGGCATTTCGCCAGGGAGGAGGCC
Sequence Type genomic DNA
Unitrap ID UNI30192

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 87782262..87782485 210
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004891 (Nes) NM_016701 nestin Gene [Source:MGI (curated);Acc:Nes]

 
Come back to gene ENSMUSG00000004891


For any suggestions or comments, please send an email to unitrap@crg.es