Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D084F08
Clone ID D084F08
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD084F08
Sequence
CGGGATGGCAGTCTGTGACATCTGTGACAACCAATACCACAGTGCATTTGTCCCTTTAATGTTGGGGTGGCAAAAGGAAG
CCATTTGTAGGTGCCTCAATAAAGAGGCAAAGGGGGAGGATGACACAAAGGCCTGATGGGGAGGGTGACCCTTGTGCTCA
GGCTTGGAGTTAGAATAGGGTTTTGAACAGCAGGCATGGGTGGAAGGCTGCTCTGGACAGATCGCAGCTTCATGGAGGAC
TCAGGATTCTTGGAGAGCCATAGGCAGTTCTTCCAGCGTCACCAGGGTCTTAAGAGTGGAAGAGGAT
Sequence Type genomic DNA
Unitrap ID UNI11614

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 157202957..157203263 307
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063019 (Manbal) NM_026968 mannosidase, beta A, lysosomal-like Gene [Source:MGI (curated);Acc:Manbal-001]

 
Come back to gene ENSMUSG00000063019


For any suggestions or comments, please send an email to unitrap@crg.es