Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D083H10
Clone ID D083H10
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD083H10
Sequence
TCATTCAGCCACAGCTACCCCCCGCTAGGACTGCTGGGAATGCTGTAGCTGGTTTGCCACCTAAATGTACTCATTTTGAG
TTTCGTGCTTTCGGCAATACTAA
Sequence Type genomic DNA
Unitrap ID UNI29864

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11708603..11708705 101
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035455 (Fignl1) NM_021891 fidgetin-like 1 Gene [Source:MGI (curated);Acc:Fignl1-001]


SPLK-Sequence tag 3SD083H10
Sequence
ATTTTCTCCGAAAACAGAAATGCGCCAGCTCTCGGACTGGACGCCTAAAATAACATCCTCATCATGAAACT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000035455


For any suggestions or comments, please send an email to unitrap@crg.es