Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D082G10
Clone ID D082G10
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD082G10
Sequence
AGAAATCTGAGACCTCAGTAGACACAAGGCTGCTGATACAGTGGGCACATGACTGGATTTTTGCTCTGATCTCATGATCT
GGATTTTTTTTTTCCTGAGCCTTACTTTTATC
Sequence Type genomic DNA
Unitrap ID UNI30196

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 100789106..100789217 108
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023033 (Scn8a) NP_001070967 sodium channel, voltage-gated, type VIII, alpha Gene [Source:MGI Symbol;Acc:MGI:103169]

 
Come back to gene ENSMUSG00000023033


For any suggestions or comments, please send an email to unitrap@crg.es