Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D082G07
Clone ID D082G07
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD082G07
Sequence
TAGTGTTCCCATGTGCTCTGAGAGCCCTTGGAGCAGNNCACATGCAGCTTCTAGAACTTGTCCAAGACCTGGCTTGGAAT
GACCTGCCTTCAGCAGGAGACAAACTGGAGGTAGGCACCATACCATCTTCCAGGTTACTTCCCGGGC
Sequence Type genomic DNA
Unitrap ID UNI30050

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 115975747..115975893 139
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029528 (Pxn) NM_011223 paxillin Gene [Source:MGI (curated);Acc:Pxn-001]

 
Come back to gene ENSMUSG00000029528


For any suggestions or comments, please send an email to unitrap@crg.es