Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D082B05
Clone ID D082B05
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD082B05
Sequence
TCCTTTCCCCTGACCATGCGCTTGCCATGTGGCTGAGCTAGCAATGGAGAATAAGTGGTCCTCATCTCCCTCCTTCCTGG
TGTGCCTCAGCATGTGGGTGATCACATACAGGCTGAGACCTGGAACCTGAGAAGTGGGCAAGAGCCTTAAACTGTGTATC
GATCATGTGTCTTACACGTGAAGCAGCAGGTTAAATGATTTGTCCAAAGCTAAAGACCCCTAGCTCCCTGCCCAAAGTAG
AGATTTTCCTAACAGCCTTAGCTATCTGATGGTCTTGCCAACCGAGATACTTTTAAGGTGTGTGTGACCGTTCACAGTGT
CACACAGGGCTCTTTTGATCTTGGAGTTCAAATTCTGTGCTGCTTGAGT
Sequence Type genomic DNA
Unitrap ID UNI30197

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 133225272..133225640 351
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043257 (Pigv) NM_178698 phosphatidylinositol glycan anchor biosynthesis, class V Gene [Source:MGI (curated);Acc:Pigv-002]


SPLK-Sequence tag 3SD082B05
Sequence
GCATTCAGTTCTCAGTCTTNNNTGCCCTTTACCAACCCCTCCCCCAGGCTGCCTTGATACATACTTTAATGAAAGTTGCA
CATATGTGAATTATTTGGTGCCTAGTGTACTGCTCTGTACTTGAAGTCCCAAGTATATGACTGTGAACAGAGGTCACCAC
CCTAGAGTTGCTGAGTTGACATAATGATGGTGTCTATGTCACTCGTACCTGGGACTCCTA
Sequence Type genomic DNA
Unitrap ID UNI30197

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 133224973..133225192 205
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043257 (Pigv) NM_178698 phosphatidylinositol glycan anchor biosynthesis, class V Gene [Source:MGI (curated);Acc:Pigv-002]

 
Come back to gene ENSMUSG00000043257


For any suggestions or comments, please send an email to unitrap@crg.es