Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D081H10
Clone ID D081H10
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD081H10
Sequence
GTTACTCGAAAGTTCTCTAGGGAAGCCCCTTTGCCCAGGATTTTGGCATTTTTGTACATCAAGTCAAACTCTGGTATTCC
TTAACCTCTTTGACAAAGCTTCATTTTTCTTGCCTATGAAATGTGTTGTTAGAAATATTTGAGC
Sequence Type genomic DNA
Unitrap ID UNI6723

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17244666..17244809 144
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050240 (Hic2) NM_178922 hypermethylated in cancer 2 Gene [Source:MGI Symbol;Acc:MGI:1929869]


SPLK-Sequence tag 3SD081H10
Sequence
CCAAAACCAACAAACAAAAGGCAAGAAAAAATACTCAATGCATGTCACCATTCTCACAGGATTGTTTGTAGATTTTGGCC
CCCTTTTTAAGACTTAGACGTTACTGAGTTTTGCCTTAGGA
Sequence Type genomic DNA
Unitrap ID UNI6723

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17244952..17245072 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050240 (Hic2) NM_178922 hypermethylated in cancer 2 Gene [Source:MGI Symbol;Acc:MGI:1929869]

 
Come back to gene ENSMUSG00000050240


For any suggestions or comments, please send an email to unitrap@crg.es