Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D081E12
Clone ID D081E12
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD081E12
Sequence
GATCTGATCGATTTCAGCCTTTCTACCTTTCCTTGTAAACAAGAAAGGGACACCCTTGGGTAGGGGAGTTTTATCTCCAG
GCCATCTTAAGATCATTCTGTGAGTGCACGGGCCTTGCTTAGTGTCTGATGGCCTACAGCCAGCACTCTGGAGCAAGTGT
AAGCAATTAGCCTTAAGAACAAGGTGCGAGTGGATACCGATGCCCGCCGGGAGTTCCGACAGCTTAGCGATTGTTGTAGC
AGGAGTCCCCTCCCTAAGTGCCAGTTTCTGTGT
Sequence Type genomic DNA
Unitrap ID UNI13399

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35643994..35644266 273
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024406 (Pou5f1) NM_013633 POU domain, class 5, transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:101893]

 
Come back to gene ENSMUSG00000024406


For any suggestions or comments, please send an email to unitrap@crg.es