Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D081D04
Clone ID D081D04
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD081D04
Sequence
GATCCATGTGGTTCACAGGTACATGGAGGCGAACAGAAACACACATTAAATAAACCTCAAAGAAAAAATATGTAGAACA
Sequence Type genomic DNA
Unitrap ID UNI27420

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101429668..101429747 74
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078941 (4921516M08Rik) NM_027592 Adenylate kinase isoenzyme 6 (EC 2.7.4.3)(ATP-AMP transphosphorylase 6) [Source:UniProtKB/Swiss-Prot;Acc:Q8VCP8]


SPLK-Sequence tag 3SD081D04
Sequence
TAGACTCTAATTCTAAGGTTAATTTTACTACATCTAATTTTTCGACAGCATATAATTTTTAAGTAAAAAAATGCTTATGT
GTATGGGTGTCTTGTCTGTATGCCAGGATTGAAGGTCTTTTACGTCATAAGTGGCTGTTTTAGATTTAAAATAGTAGTGA
AGCT
Sequence Type genomic DNA
Unitrap ID UNI27420

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101429763..101429927 161
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078941 (4921516M08Rik) NM_027592 Adenylate kinase isoenzyme 6 (EC 2.7.4.3)(ATP-AMP transphosphorylase 6) [Source:UniProtKB/Swiss-Prot;Acc:Q8VCP8]

 
Come back to gene ENSMUSG00000078941


For any suggestions or comments, please send an email to unitrap@crg.es