Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D080H10
Clone ID D080H10
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD080H10
Sequence
TTGATGAGGAAAATGAGTTTAGTTTTTTGAATATAGTAAGTCTTCAGTGTCAGTCTTTGAGGGAGTTCTGATATACCAAT
TCACATCCCATCGTTGCTTTTGTAATTTCTTGACAAGAATTCCTTAGCCTAGTGTGAATCAATGAGAGGCCCTCTGGTGT
TTCTTGTCAGTTTCTGTCTGTGTGCTGAAGTCCGTGGTGTCCCCTTTCCCATGCCTCAGTTCTGTCGTTAACAGGCATTT
CATGAGGAGTACTCCAGGCTCTATCAGCTTGCCAAAGAGACACCCACCTCTCACAGTGACCCTCGCCTTCAGCATGTTCT
TGTCTACTTTTTCCAAAATGAAGCACCCAAGAGGGTAGTAGAACGGACCCTTCTGGAACAGTTTGCGGATAGAAACCTTA
GCTATGATGAGAGGTGAGAATGTGCCAGCCTGTTCCTGTGTGGGGTCTTACTCGGCAACTTCCTCCAATATGGAG
Sequence Type genomic DNA
Unitrap ID UNI30201

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 48843464..48843938 475
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032267 (Usp28) NM_175482 ubiquitin specific peptidase 28 Gene [Source:MGI Symbol;Acc:MGI:2442293]

 
Come back to gene ENSMUSG00000032267


For any suggestions or comments, please send an email to unitrap@crg.es