Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D080G05
Clone ID D080G05
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD080G05
Sequence
GATCTCAACCCAAAGCTGATCCTTGNNAGGAAAGCCAAAGAAGATACTATCGTAATTTGAATTGTTTTGGGGTGAGCATT
AGGCGATCATAACTGGGGGTACAGTAAAGTCGGTGTCCTAACTATATTAGGAAGATGGACTAGAGGAGTGGTCGGTATCT
CAGGGATTGCTAGGGTTGACAAAGCACGCTAAG
Sequence Type genomic DNA
Unitrap ID UNI30202

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 107850653..107850845 183
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014856 (Tmem208) NM_025486 transmembrane protein 208 Gene [Source:MGI (curated);Acc:Tmem208-003]

 
Come back to gene ENSMUSG00000014856


For any suggestions or comments, please send an email to unitrap@crg.es