Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D079H09
Clone ID D079H09
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD079H09
Sequence
ATGTGGAGGTCAGAGAAAACTTGAAGTTGGTTCTCTTCACTATGGATTTCAGG
Sequence Type genomic DNA
Unitrap ID UNI6723

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17243348..17243401 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050240 (Hic2) NM_178922 hypermethylated in cancer 2 Gene [Source:MGI Symbol;Acc:MGI:1929869]

 
Come back to gene ENSMUSG00000050240


For any suggestions or comments, please send an email to unitrap@crg.es