Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D079B06
Clone ID D079B06
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD079B06
Sequence
CACAGATCAAAATCAGAACTCTTTCTTGCCTTCTCTTGAGATTATCTTCAGTTTACCCTGTCCCACAGGCAGGCAGCCCT
GGAAGTCACTGCTCGATACTGCAGCCGAGAGCTGGATCAGTATGGCCAATGTGTGGCAGCCAAGCCAGAGTCGTGGCATC
GAGATTGTCACCACCTT
Sequence Type genomic DNA
Unitrap ID UNI15926

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 128955846..128956022 177
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037938 (Chchd5) NM_025395 coiled-coil-helix-coiled-coil-helix domain containing 5 Gene [Source:MGI (curated);Acc:Chchd5-001]


SPLK-Sequence tag 3SD079B06
Sequence
CGTCCTCCCAGTGAGTGTACAACTGGGGGCTAGAGGGTGCCAGGCAGTAGGGTTTGAATGCTTCAGGGTCTAAAATGCCC
TACCCCCCACAGCCCGATCATC
Sequence Type genomic DNA
Unitrap ID UNI15926

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 128956045..128956146 102
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037938 (Chchd5) NM_025395 coiled-coil-helix-coiled-coil-helix domain containing 5 Gene [Source:MGI (curated);Acc:Chchd5-001]

 
Come back to gene ENSMUSG00000037938


For any suggestions or comments, please send an email to unitrap@crg.es