Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D078G03
Clone ID D078G03
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD078G03
Sequence
GGATCTGCTGTCATCCTGAGCCTCACTCAAGTAAAAATAAAAGGCAGGTCAGTTGCTGCCGCATCTTCATTTTTGCTGGA
TTCTGCTTCCGGCATTTTCTGGTTATTACAGATTCTGGTTTCCCTCCACTTTGCTTCTGCCCTCGTATATCTTGATGGTT
TCTACTCTTAGTAAGGTAATTTATAAACGGCTTCTCCCACCCCTGAAATTGTACATATGTTCTCATATACATTTGCTTCA
TAATGTGAAGTCTTTCATCCATAACATTTATGTTAGAATGCAGTGTAAAATGGAACCTAGCCTTCCCTACACATTTGAAA
TGATTTAACAGGTAATAAAAGGATTAAGGGTTCTTGATTAATTCAGTTTCTTTGATCTACCAATCAACTTTTCATTTCTT
ATAATTACGGTCATTTTATGATAATGTATCAATACCAAGTAAGTCCTTGGTTCTTCTCAAATGTAGTTGGAGGACCATTG
AGACGGAAGTAAAGGCACAGCGTTATTCTCAGACTGTCACACGTGAGCCATGGCGCACACACATTGATAATAAACATGGC
GCACACACATTGATAGTAAACAACATTTTACATTAGTGAGAACTTTTTTCATTTAGAAATTAATTTATCTTTAAAA
Sequence Type genomic DNA
Unitrap ID UNI1985

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22402089..22402724 614
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013089 (Etv5) NM_023794 ets variant gene 5 Gene [Source:MGI Symbol;Acc:MGI:1096867]


SPLK-Sequence tag 3SD078G03
Sequence
ATCATAGTGAGTGTTCATATGGTATTAAACAATATGCTTTTTTTCCTTCCAGATTTCAGCGACAGNNGTTGGGGCCAGGC
ATTCCTTTCCTTCTTAGGCCAGAGGTCCTGGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000013089


For any suggestions or comments, please send an email to unitrap@crg.es