Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D078F05
Clone ID D078F05
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD078F05
Sequence
AGGTAATATGCTTCTGTGTTCTGGGTATCTTATGTAGAGCCATGTGTATAGCAGGCACGCATTCTATCACCAAGCTATAT
CTCTGTAGAAACAGGTGATTTGTAATAACTGTTTGTTAAACTACAGTGTTATCCTTCAAAATATCTTTTCAGAAATTGTT
TAAAAACTCCTTTGCCCTATTATTCTATGTTCTTCAAGTACTTTCTCAGTTTTTTCTTGAAACCTATATTTTATTTCATG
CTATCATGCATTTGTGAAAAGAAGTTGGTATTCTTCGAGATATTGGGTTTTAATGTTCAAACTAACAGTAATTAAAAGAT
GTTTTTCTTTAGAAAACAGAGTAGTTGTTTTTTACAGGACAGGATAAGATGACAGTAAGAAAAGCAATTTGGTTGTTTCT
TAGGAAATGTGAAGTTATAGTGCATTTTGAATACTGTTTTCTTTTAAAAGACCACTGTGATAAAATTAAGCATTTATAAA
AATCAAAAGGAAGATAAGGATTATGTTCTCAAGGTACTTATAATAAAGAGTAAAAGAATAATGATCAGATTATAAGAAAA
GGTTCAGTAGACGTGCAGTTATAATGACTAACAGATATCAGGATGTTTTTCTGTGGGTATGATGGAACTAAGTTAAAAGG
AAGAAGTAGGAATTAATTAAAATAGAACATTAGAAGACTGGAGTCCACAGAGAAAGGAGGCTGAGCACCTATTTAAAAGC
TACCTGGAGAGATNCTGCACACCTGGTGATTGTGGCACCTTGTAGACTAACCAGTCTGGATGCCCAGACTTTAGTTATTT
CCTGGGGCTAAAATCTGTAGTAT
Sequence Type genomic DNA
Unitrap ID UNI24432

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 121540362..121541183 817
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026383 (Epb4.1l5) NM_145506 erythrocyte protein band 4.1-like 5 Gene [Source:MGI Symbol;Acc:MGI:103006]


SPLK-Sequence tag 3SD078F05
Sequence
ATATATTCCGCNNNTCTTCAGCTCATGGATAGTTACATTTTATTATAGCACTATGCTCTTACGATTACCCCTTTGTGGAG
AGCANNCCCATTGCCACCTCTAGCTGAAATAATAACTTAATTTGCATGCTTATCAAAAAAAACCCACGTTGCCTGGAATT
TTGCTGCCTCCTCCTTTCCCAAGCATCTGCTTTCCTGGGTTCCTGTTGCCCCTTTCTGACTTGAAAATTGAAGCTGTCTG
GGGCCTTGAGAACAGCTCTTCCCACTGTATGCCCTGCCACTGGGAGCACCTCCCTGGCGGGGGTTACTGTAGCAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000026383


For any suggestions or comments, please send an email to unitrap@crg.es