Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D078C11
Clone ID D078C11
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD078C11
Sequence
TGGGATCTCTCTGCCCTCCCCCTTTTAAATTACAGGCGTTCATTAATGAAATTTCTGGAGGCTGGGAAGCCCCAAAATCA
ATGCACTTGAAGAGTGCATGATCAACGGAGCCTACCTTTTCTTCTCTGCCTTCCTTCCATCTTCCTTCTTAGTAAAGGTA
GACAAGAATTAGACAAGAAAAAAATGCCCATTGAGTTTAATTTGAGTTGTTTACAAAATTGTTGAGATTT
Sequence Type genomic DNA
Unitrap ID UNI29712

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 40213284..40213513 220
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040111 (Gramd1b) NM_172768 GRAM domain containing 1B Gene [Source:MGI (curated);Acc:Gramd1b-002]


SPLK-Sequence tag 3SD078C11
Sequence
ACTTTGATGCTTGCTGTCCAGTGAGAGGAAATAGACATAGAACAAAGAAGCCGCCAAGTCATAGGAAAGGCTCTGTAGAG
AATGAAAGAGGACGATAAAGCCAGTAAGGACAGAGGTAGACAGAGAAGAGTTACTGCCATAGCAACACTGAGATCATGGC
CAGATGGTCTACTTCTGAATGGCGGTAGTGAGGACAGAAAAAGAGGAGCCAATTAAAAATGTGAGAAATAGAGCTGCCGG
GAGTGACATCCAGGTTGGAAGGCTGTNNNGGATGAAGCTGAGGTTTTCTGGCTTGTGCAGCAGGAAAGGCGGCACAGTCT
GGAGGCTAAGCGCCTCCTACGCTGTAATCACAGGTCTAGCA
Sequence Type genomic DNA
Unitrap ID UNI29712

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 40212290..40212650 351
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040111 (Gramd1b) NM_172768 GRAM domain containing 1B Gene [Source:MGI (curated);Acc:Gramd1b-002]

 
Come back to gene ENSMUSG00000040111


For any suggestions or comments, please send an email to unitrap@crg.es