Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D078C04
Clone ID D078C04
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD078C04
Sequence
ACAAATGCACATATTACAAGGGTGCAAGGAGAAAAGCAAAGGCATTTTGTATGAAGATGGATGCAGTGGGAGCCCTAGAA
AGTTTATTCTTTTAGAAAACTTACCACCATTTTTGTTATCAGGAAACATGTTATATACATTATAAACATAAGAGTGTACA
GTGCATCAGAAGACAACTTTACCTTAAAATCTTACCCCAAAACCGCTTTGAATGTTATCACCTTGGGAGAAAGAGGAAGT
AGGTTTGTTTTGATGGGAGAGGCTATAGTAGAAGATATACTCACAAGGCAGGATGAAATTAGTTGT
Sequence Type genomic DNA
Unitrap ID UNI38

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 35775879..35776184 306
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022849 (Hspbap1) NM_175111 Hspb associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1913917]

 
Come back to gene ENSMUSG00000022849


For any suggestions or comments, please send an email to unitrap@crg.es