Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D077G04
Clone ID D077G04
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD077G04
Sequence
ATGCCCTTTTCTATTCTGCAGGCTTATGTGGTCCTTGGCCAGTTTCTGGTGCTAAAGAAAGATGAAGACCTCTTCCGAGA
ATGGCTGAAGGATACATGTGGTGCCAATGCCAAGCAGTCCCGGGACTGCTTTTGGGTGCCTTCGAGAATGGTGTGATGCC
TTCTTGTAGTGTTCTCTGGGGATCCC
Sequence Type genomic DNA
Unitrap ID UNI11948

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5364995..5365179 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024844 (Banf1) NP_035923 barrier to autointegration factor 1 Gene [Source:MGI Symbol;Acc:MGI:1346330]

 
Come back to gene ENSMUSG00000024844


For any suggestions or comments, please send an email to unitrap@crg.es