Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D077F02
Clone ID D077F02
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD077F02
Sequence
GATCTCTTTGGATCAGTGTAACAAAATAGTCGAGGCAGCACTCTTTTGTTTAGCTCACAGTTCTGAAGACTTAAGAACAT
GGCATCATAACTGTTCAATTCTGGAGAAGCGCTCATGTCAGGCATCACAGTGATAGGAAGTGAGAGAGGTCACATGGTAA
CACAGCACCCAGG
Sequence Type genomic DNA
Unitrap ID UNI30214

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 40935418..40935590 165
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038417 (Fig4) NM_133999 FIG4 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2143585]

 
Come back to gene ENSMUSG00000038417


For any suggestions or comments, please send an email to unitrap@crg.es