Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D077A06
Clone ID D077A06
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD077A06
Sequence
AAATTCATTCCTGCTCAGAAAATAGTATCTACAGNNNNNNGTCTGGTTATGTAGCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD077A06
Sequence
CGTGNNTTGTATTTAGAATGGAGTCCCCTACCTGATGTATGTGTCAATACCTAGAAATCAGACACACTCCTGACCCCGAG
CAGTTGGACTAAAGATACTTTTCAGTTGTGATAACTGGTTCCAGGCCATACGCAGTCGCTACGGCCTGAGGGGGGAACCT
TCCAAAGGGAAGAAATAATAATTCATAATCTATCATATTTCTAAGTTCTGGGGACCCTATAATGCAACAACCTGTCAGCT
AAATAATGGTGCACGCTGTTTCTCCCCAGGTGACGACATAGCTTAAGAGATATTCTCAGAGTCACTGCTGAAAGAACAGA
TTATGTATTCAGAATT
Sequence Type genomic DNA
Unitrap ID UNI29864

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11708097..11708432 332
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035455 (Fignl1) NM_021891 fidgetin-like 1 Gene [Source:MGI (curated);Acc:Fignl1-001]

 
Come back to gene ENSMUSG00000035455


For any suggestions or comments, please send an email to unitrap@crg.es