Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D076A06
Clone ID D076A06
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD076A06
Sequence
GATCTTTGCATCCTTATTCATGAGATACTTTCTTAGATTGCCTTCCTTGAACTGTTTTTTTTTTCCTCTGTCTTCGGCAT
TGGAGTTCATTAGGATTTGTCTGCTGTATTTCTTAGGATTTGGCCGGATTTAAGATATAAGCAGTCTGTCAGTGGGGCTT
CTCCCTGGTAAGACTAACCCTGACCGTGGAGAGGCTGCTAGGCTTCCCTC
Sequence Type genomic DNA
Unitrap ID UNI14633

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148335924..148336133 210
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025495 (Ptdss2) NM_013782 phosphatidylserine synthase 2 Gene [Source:MGI Symbol;Acc:MGI:1351664]


SPLK-Sequence tag 3SD076A06
Sequence
TTCTATGTGCTATCCGTGTCCGGTTAGGAGCTAGGACTTGGGGTTCACTATCTCAGGGTTGTGTATCTATGTATTATGGA
GTTCCTCTTGAGGAAAACCTGTCTCTATCCAACCATGTGTTAAGTGTCTAATAATTTGTTCTTATCAGCATGACTCAAAG
TTATTTGTTCAGGTTGTATACTCAAATACTGCTTTTATGTTTTTGCTGAAGTTCTTTAGACCC
Sequence Type genomic DNA
Unitrap ID UNI14633

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148336181..148336403 217
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025495 (Ptdss2) NM_013782 phosphatidylserine synthase 2 Gene [Source:MGI Symbol;Acc:MGI:1351664]

 
Come back to gene ENSMUSG00000025495


For any suggestions or comments, please send an email to unitrap@crg.es