Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D075G09
Clone ID D075G09
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD075G09
Sequence
GACCCTGGACTCTCAGACTCGGACTTTTATTGTGGGGGCCCAGGT
Sequence Type genomic DNA
Unitrap ID UNI26926

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35273138..35273182 45
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024392 (Bat3) NM_057171 HLA-B-associated transcript 3 Gene [Source:MGI Symbol;Acc:MGI:1919439]

 
Come back to gene ENSMUSG00000024392


For any suggestions or comments, please send an email to unitrap@crg.es