Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D075F03
Clone ID D075F03
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD075F03
Sequence
GATCCAGTGGCTTCATTGCAGTGTGGTCAAGTTACCTGTCCCTTTATGAAAAGGAGGTTAGTTTTGTGCAGCCATTCAGT
ATGCAAGTCACATGCTCATTCTAGGGTATATTTCTGCATGAGATCTTGGTAGGAACTAAATATTTTAGATCTTGAAAGGG
ATATTGTTCTAAGTAA
Sequence Type genomic DNA
Unitrap ID UNI14535

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 47558080..47558255 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032076 (Cadm1) NM_207675 cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Cadm1-001]

 
Come back to gene ENSMUSG00000032076


For any suggestions or comments, please send an email to unitrap@crg.es