Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P068D01
Clone ID P068D01
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P068D01
Sequence
CGCCGTGCACCGAGGCTTGTTTCACATCTTAACAACAG
Sequence Type mRNA
Unitrap ID UNI10489

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110019862..110019900 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032480 (Dhx30) NM_133347 DEAH (Asp-Glu-Ala-His) box polypeptide 30 Gene [Source:MGI Symbol;Acc:MGI:1920081]

 
Come back to gene ENSMUSG00000032480


For any suggestions or comments, please send an email to unitrap@crg.es