Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D073G10
Clone ID D073G10
Vector rFROSAbgeo+1s
Project ggtc

Sequence tag D073G10
Sequence
ATCTNNNGTCCCGAANNNGAAGACATTGAAGATGAATTACAGGTTATTNNNTGGGAGGTTAACAGTGACAAAGAAGATCC
TGGTGGGCCTAGTGAGTGTGAAGATGATAAGGGTACCCTGGACATCACAGATTGCGATTCCTGNNCAAGTCGTATCTAGT
GATGGCAGTCTATCATNNGCCTTCACAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SD073G10
Sequence
TTTTTGTCTTTTATTTGAGAACCAAATGCTCTCAGCTGGGATAGAACTTCACATATATTATAAGCCGCAACAAGCGACTA
TGCTTCGCGAGAATCACTCGTTAATCGTCCATGCTATAGTTCAGGAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD073G10
Sequence
CAGGAGCAAAGGACACTTAGCTCCCAGGAAAATGTTGTATATTCCTGG
Sequence Type genomic DNA
Unitrap ID UNI4069

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 16085640..16085687 48
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041974 (2310008H04Rik) NM_146068 RIKEN cDNA 2310008H04 gene Gene [Source:MGI Symbol;Acc:MGI:1924834]

 
Come back to gene ENSMUSG00000041974


For any suggestions or comments, please send an email to unitrap@crg.es