Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D073C08
Clone ID D073C08
Vector rFROSAbgeo+1s
Project ggtc

Sequence tag D073C08
Sequence
GTGGCGCCCCCAAGAAACTACTCAATGCTGAAGCCCTTCAAAGTGATAGCGGAGACTTTGGAAGCACCATGGATGGGTTT
TGTGATCAGCAAGTCCCTTTTATGGTCCCAGGGAAATCTCGATCAGAGGACTGTCGAGGGCGACCTTTGATTGACAGAAA
GAGGAAGTTTGTGGACACAGATCTGGCTCACGATTCTGAAGAGTTGTTTCAGGATCTTAGCCAGCTGCAGGAGGCTTGGT
TAGCTGAAGCACAAGTTCCTGATGATGAGCAGTTTGTCCCAGATTTTCAGTCTGATAACT
Sequence Type mRNA
Unitrap ID UNI4752

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22436083..22436617 107
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013089 (Etv5) NM_023794 ets variant gene 5 Gene [Source:MGI Symbol;Acc:MGI:1096867]


SPLK-Sequence tag 5SD073C08
Sequence
TTTTTTTTTTTCAAAGCAGGGTTCAAGTCCGATTTTTTTTTTTCTTTAAACCATCTCATTTGTTTCAGTAGCATTTGTAA
TAACAACCAGCATCTTGAGTAACTGAAATAGTTTATGCTAAG
Sequence Type genomic DNA
Unitrap ID UNI29874

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22431865..22431986 116
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013089 (Etv5) NM_023794 ets variant gene 5 Gene [Source:MGI Symbol;Acc:MGI:1096867]


SPLK-Sequence tag 3SD073C08
Sequence
AATCTCATTGTAGAGCATAGCTCTGTACCAAATTCACAAACTTTGTATTAAAATTCAGATGACCCCATTTTCCCCTTGGA
TTAAAAAAGGGGGGCAGGGATATGACTTCGGAAGTACAAGTAATTTCCTAAGGACCAGCTAATTAACTGTTAAACATCAG
CTTTCCAGAAGTACAGTGCTGTGGC
Sequence Type genomic DNA
Unitrap ID UNI29874

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22431666..22431850 181
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013089 (Etv5) NM_023794 ets variant gene 5 Gene [Source:MGI Symbol;Acc:MGI:1096867]

 
Come back to gene ENSMUSG00000013089


For any suggestions or comments, please send an email to unitrap@crg.es