Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D073B05
Clone ID D073B05
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD073B05
Sequence
GATCCAAGGCCGGTACCCCGCGCCATGGCCGGAGACATCGCTTCTCGCATGAGCTTCAGCTCACTCAAGAGGAAGCAGCG
CAAGACATTCTCGGTGCGGATCGTCACCATGGACGCCGAGATGGAGTTCAACTGCGAGGTATCCGGCCGCCGACACCGAC
GGGCTGTGAGTGGAGAGCCGCGGAATCTCTGCCTGTCTGGTGGCAGCGACGCGGGTCCCTACCCATGGGGTGCCCTCGCT
GTGGTGACAGTCGAAGTGCAAGCTTAAGGGATTCCGTATATATCATTATCTGGAACCGGAAGAGGCTTTCTAGGGCCAGA
TCACAAGTTAAAGCTAGTTGTTTGTTTGCTTGTTTGTTAAAGTGGGGTTCTTGGTTTTGGCATTTCCCGAAGGTTATTTT
CATTCATTTGTTATTGGGAAACACTGGAATCTTCCGTAGAAACGAACCGGTGTGCAGTGTGTAGAACTCGCGCCTAAAAC
TCCAGGGAGTTTTTCGCTAGGTATTAACTGTGTACCCTAGGTCTTAAAAGTTACATCTAGTTATATTGGAAGCTCGTACT
TTTCCCTGTTCCAAAATTTTCAGTTTCTGGAAAAAACTCTTTGAGGAAAGAGTGTCTTACATTTACTCTTTATAGTTTCT
AACATGATGATAATAGCTATCATTTTGTTGAAGA
Sequence Type genomic DNA
Unitrap ID UNI30221

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4748339..4749012 662
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009073 (Nf2) NM_010898 neurofibromatosis 2 Gene [Source:MGI (curated);Acc:Nf2-001]


SPLK-Sequence tag 3SD073B05
Sequence
CTNGGTTATATCCACAACCCTGAACACTTGCTAAGTGTCAGACATTTACACATTTGACTCT
Sequence Type genomic DNA
Unitrap ID UNI30221

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4748190..4748250 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009073 (Nf2) NM_010898 neurofibromatosis 2 Gene [Source:MGI (curated);Acc:Nf2-001]

 
Come back to gene ENSMUSG00000009073


For any suggestions or comments, please send an email to unitrap@crg.es