Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D073B02
Clone ID D073B02
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD073B02
Sequence
AAAATTGTTTTAAATTACATTTTCTATTTATGTTATGTGTGTGGGAGTGACTTGTGTGGTCCTAAACCAAAAGTTTTATT
ATAAAATGTCAGGAAACATCATTATATCTAGACCCAATTTGGCCTTACAGAATAAATACAAGAAGTTCTGCCAAATCTGT
AGGTAGATGTTTTGCCTTTGAGCACTGATGACACCAGACCTATAATATATTCTATTTTACATTAATTCCTTTATTTGTTT
ATATGTCCACTTGTATTTATCCATGAGGACAGTAGTTGCTCCTTGCATGAATGCTAATTTTCTGGGGAGCCCATCCCCTG
AAGCAATGGGGACTTAAATTTGACCCATCTTGTGGAGCCAAGCTGATAAAATGATAGAGATGCCACACCTTGACTAAGCC
TGCTTAATAG
Sequence Type genomic DNA
Unitrap ID UNI30222

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 147061022..147061431 400
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029635 (Cdk8) NM_153599 cyclin-dependent kinase 8 Gene [Source:MGI (curated);Acc:Cdk8]


SPLK-Sequence tag 3SD073B02
Sequence
CCCATCTTTAAGTTAGATCCTAAGCCTCTGCCTACATTATACACCTATCGTCGTTCAGCGCTATCTCCTCAAAACACAGT
TCTACTGTGTTCTCTAAGTATTTGGGCTACTTTAACAATTTAAATTTGTACTTATAATCCACATTGTATCTTACATAATA
TAAAAACACAGTATGTGTAGGTAGCTTAAATACAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag D073B02
Sequence
CCTNNNCCTCTATTGGTCGAGCTCCTGTTTGTATTCGAGGGNNNCTAATNNGCTCGAGGCACTTACGCGCACGTCTTCAA
GGCGAAGAGGAAAGACAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000029635


For any suggestions or comments, please send an email to unitrap@crg.es