Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D072E12
Clone ID D072E12
Vector rFROSAbgeo+1s
Project ggtc

Sequence tag D072E12
Sequence
GGCGTTTTCTAGCCCTTNNNNAGCAGAAGTGGGGCNNNGATGCCTCAGCCATCATGGCNCCCCAGGAGAGNNNGAGGNNN
NAGACAAAAAGNNNNAAGCTGTCCCACAGTCCTCAACCTCCCAATTTGGGGGATCCGGTTGAACATTTATCAGAGACATC
TGGTNNNTCTTTGGAACCCATGTCCGAGGGAGAAGTACCGAGTCCTTTCCCCAGAGGCAGTCGTACTCGCGCGAGCCTTC
CCGTGGTGAGGTCGGCCAATCAAACAAAGGAAAGATCCCCAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SD072E12
Sequence
GTCTGTGATATAAAAAGTGGTACCCTATTTGCAGTTCAAGGAGATTCACCTTTGCTTCTAGCACATAGCCCAAACCTAAT
CAGATTGGTCATGAAGTTGCTGNNGTACCCACCTTCCTCAGTAACAGTTAACAAATGCCCTGCTGGTGGTTTAAACCCAC
AGCTATGTGTCCGCCAGAAGGTAAGACCTTGCTGTGCTTAGCTCTGGCTACAATTTATAGGTACTCTAGTCCTAGTGTAT
AACACACTAA
Sequence Type genomic DNA
Unitrap ID UNI15271

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20615931..20616180 240
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]


SPLK-Sequence tag 3SD072E12
Sequence
ATCTCAGCCTTGAGCAATGTTACCTGCCCCCTCAGGTTCTGCCTGTCTACTGTGCATGGTAGTTGGAAAGATTCTTCGCA
ATAACAGTCATGTCACATCCCTCCTCAGTACCAAGAGTTTCTTTGCTCATCCAGCTTGGGGGTATGG
Sequence Type genomic DNA
Unitrap ID UNI15271

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20616407..20616553 147
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]

 
Come back to gene ENSMUSG00000036617


For any suggestions or comments, please send an email to unitrap@crg.es