Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D072D07
Clone ID D072D07
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD072D07
Sequence
GATCTTTTGCAGACGTCCTGCTTCAAACTCTCTGTTTAGCCTGGATGCCTGATGCTCTTTCCTCAGCCTCTGAAGATGGT
ATTGTAGTGGTGGAAAGGCGCTTGGCTTTGTAGTCTGTGAGTCCGCCTCACAGCAGGTCCACCACGTGAAAAGGCTAGCC
TGGGCTAAGGGAGGTCTTCAGAAGATGGTTGTTTAGATTCTTACCCAGCTTCAGATTTTAGACCTTGATGCCTTTGCCTG
ATGGACGGTGCTGCCATTAGGTTTAGCGTGGAACATCCTATGTATTGGGGATTTTAAAATAAATGAGCACTCACTCACCA
CTAGCTGAGGCACTTTGGAAACAGAGGCAGGAGGAT
Sequence Type genomic DNA
Unitrap ID UNI11601

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 51955335..51955690 344
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019891 (Dcbld1) NM_025705 discoidin, CUB and LCCL domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1913936]

 
Come back to gene ENSMUSG00000019891


For any suggestions or comments, please send an email to unitrap@crg.es