Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D072B09
Clone ID D072B09
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD072B09
Sequence
AACTATTGCCAGTAAAAGCAGTACATGCCTATACTGTT
Sequence Type genomic DNA
Unitrap ID UNI30227

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 20212000..20212037 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002983 (Relb) NM_009046 avian reticuloendotheliosis viral (v-rel) oncogene related B Gene [Source:MGI (curated);Acc:Relb-001]


SPLK-Sequence tag 3SD072B09
Sequence
AAGGCCATCCTCAGCTACTTGTCTTGTTCAAGGCCTCTCTGA
Sequence Type genomic DNA
Unitrap ID UNI30227

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 20211699..20211740 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002983 (Relb) NM_009046 avian reticuloendotheliosis viral (v-rel) oncogene related B Gene [Source:MGI (curated);Acc:Relb-001]

 
Come back to gene ENSMUSG00000002983


For any suggestions or comments, please send an email to unitrap@crg.es