Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D072A04
Clone ID D072A04
Vector rFROSAbgeo+1s
Project ggtc

Sequence tag D072A04
Sequence
CNNAGGATGTTAAGCACGTGGTTTGGCACCCGAGCCAGGAGCTTTTAGCTTCTGCTAGCTATGATGACACAGTGAAGCTA
TACCAGGAAGAAGGGGATGACTGGGTCTGCTGTGCCACCCTCGAAGGTCATGAGTCCACTGTTTGGAGCATAGCCTTTGA
TCCCAGCGGCCAGCGGCTGGCATCTTGCAGTGATGACCGAACTGTNNNCATCTGGCGCCAGTATCTACCGGGCAATGAAC
AAGGGGTGGCATGCAGTGGCTCTGACCCCAGCTGGAAATGTATCTGCACTTTGTCGGGCTTCCACACCAGGACCATTTAC
GACGTTGCTTG
Sequence Type mRNA
Unitrap ID UNI10409

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 127070649..127072186 200
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003662 (Ciao1) NM_025296 cytosolic iron-sulfur protein assembly 1 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Ciao1-001]


SPLK-Sequence tag 5SD072A04
Sequence
ACACCCCTACTAAGTAAAAGCAAAGTTTATGACATTTTCTGTGCTAAAACTGAAATTTACTTTGAGCTAAGGAGGG
Sequence Type genomic DNA
Unitrap ID UNI10409

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 127069939..127070014 76
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003662 (Ciao1) NM_025296 cytosolic iron-sulfur protein assembly 1 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Ciao1-001]


SPLK-Sequence tag 3SD072A04
Sequence
AAAAGAGGATAAGTTATGAGAAAACTTGTTAGTATTAAAAGGAGGTTAAG
Sequence Type genomic DNA
Unitrap ID UNI10409

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 127069268..127069318 47
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003662 (Ciao1) NM_025296 cytosolic iron-sulfur protein assembly 1 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Ciao1-001]

 
Come back to gene ENSMUSG00000003662


For any suggestions or comments, please send an email to unitrap@crg.es