Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D071F06
Clone ID D071F06
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD071F06
Sequence
GGATCTGTTTATGTCTTATCACAGATGAGAAGACTCATTTGATCTGCCTGAACCTGTCTTTCTACTTCTGTTATAATACA
GAATGGTCCCATTACAATAACCTGGATGGTTCATAGTCTTAATTTCAAACATCAGAAGCTTGTATACATTTCACTCAGGG
TTTAGACCAGGTTCTTTTCTTAGAAAGTAATCAATTCTTTG
Sequence Type genomic DNA
Unitrap ID UNI2754

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110304020..110304220 201
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036057 (Ptpn23) NM_001081043 protein tyrosine phosphatase, non-receptor type 23 Gene [Source:MGI Symbol;Acc:MGI:2144837]


SPLK-Sequence tag 3SD071F06
Sequence
GGCTTGGCCTAGCGTCGCACAGTCTCATTCAGCCACAATANTTCACTAGAAAACCATGAGATCGCTATCATCTCTCTAGA
GCTGCTGGAAGTACAGANATGGCGGGCTATGTACAGCTGTTCATGCGCATAGCTGAGAAGTGACTCAAGCCCTCATGTTT
GCTGTGAGAAAAGCACTTTCCCAACAGAACTGACTCTACCTAGCTCCCTCATCCCCCACACC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000036057


For any suggestions or comments, please send an email to unitrap@crg.es