Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D071E09
Clone ID D071E09
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD071E09
Sequence
GGACCTTTGCATAAAGATTCTAGAGCGCCCACCCGATCCCTTGTG
Sequence Type genomic DNA
Unitrap ID UNI30025

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 74650672..74650716 43
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000282 (Mnt) NM_010813 minute imprinted gene in the Igf2 region Complex/Cluster/Region [Source:MGI (curated);Acc:Mnt-001]


SPLK-Sequence tag 3SD071E09
Sequence
GATGGAGGGTCCAGAGACTATAAGTTAGGAGCATTGAGGTACCCTCCAAAGGTTGGATGGGCTCAACACAGGACCAGCAC
TTTTAATTTATAGAAAACGTTAGGGACACCTGGTCAGTGGTGGTATGGGTGATGTGGGTCCAGAAGGCCTAATTTGGGCC
TTCCTCCCTGAGCCTCCTATCTGTCTGGGTTTCAGGATCGGAACCAGAGAAGTCCACAACAAATTGGAGAAGAACAGGTG
TGTGCGCGCGCACTTACAAGTGTGACTCTGGGCCCGTCCTTCCTGGTTCCCCAAAAGCGTCATTGGGTTTGTCCCTGCCT
CCAGCTCCTGTATATACCCAGGCGTTGGCTAACCAGTGTTCACCCCCTTTCCCCAGGAGGGCCCATCTGAAGGAATGTTT
TGAGACCCTGAAGCGCAACATCCCCAACGTGGACGACAAGAAGACTTCGAATCTGAGCGTGCTGCGGACGGCGCTGCGGT
ACATCCAGGTATGGGGAAGGGAGGCAGGGCTGGGCGGTGCCTGGACGGCCACAGCGCCNNNTTCCTCCTGCTACCGGCNN
NTTCCCCCGCCCGTCTCCACGCGGGCGCTAAGCACATGGCCTAGCTGACG
Sequence Type genomic DNA
Unitrap ID UNI30025

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 74650737..74651347 591
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000282 (Mnt) NM_010813 minute imprinted gene in the Igf2 region Complex/Cluster/Region [Source:MGI (curated);Acc:Mnt-001]

 
Come back to gene ENSMUSG00000000282


For any suggestions or comments, please send an email to unitrap@crg.es