Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D071D06
Clone ID D071D06
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD071D06
Sequence
GATCTGTGCGTATCATGGACCACTAGGGAGCAGTCACACGGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD071D06
Sequence
AGGGCTGGTTATAGAGGTAACCCTTTCTCCCTTCCAGTGCCCCATCTCTCCATCTTCCACCCACGGAGGCTCCTCACACT
TGGAATGGGAACGGTCCTGGTTATATGTGTCTGTCTGTATAGCTGTCCAGGCATGTGTAAATGCACGTGTGTCGCTGAGT
ATCACAGGGTCAGGTCAGGACGTCCTTATGGCTACTGTTTCCAGGAAGGCTGCCAGTGATGAGCCTGGTGCTATGATAAC
AAATGCCTGTGATGTCTGAGGCTGACCGTGATAGAAAGGTGTAGGAAATGTGTGTTGTGTCTGGTGATGGTATCGGAGGC
TATCTGATAGGTCTGTGATGGTGACATGCTTGAGGGGTAGTCTGTGCTTCATGTGAACGGTGACTGAATGACCTGCCTGC
CATGTGGACATACAGGCCAGGGGATGGACTGCAGATGTCACGGAGATTTGTCAGGTTTCACAGCTGTGTGTAAGTAACCC
TAG
Sequence Type genomic DNA
Unitrap ID UNI29838

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 108488633..108489117 477
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017765 (Slc12a4) NM_009195 solute carrier family 12, member 4 Gene [Source:MGI (curated);Acc:Slc12a4-001]

 
Come back to gene ENSMUSG00000017765


For any suggestions or comments, please send an email to unitrap@crg.es