Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D070E07
Clone ID D070E07
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD070E07
Sequence
TCAAGAGTGAGGGAGAAAAAAAACCCTATATTTCATTATACAATGAGATGAAGTTTAGCAAAGAGACACATTGAGTGAAG
GGTTTCTGAAGATAAAAGTGAGTTCAGCTTGGCAGACGGCCCTAGGTCCATGCTAATGACAGGGTTAAATGATAGGAAGA
GCGTGCCTATGAAGTCATTTTGTGATTCTGTTGGACCTCACCTCTGAGGCTAGGTGAGTTTTAGTTGTGGTTGTGAACTG
GG
Sequence Type genomic DNA
Unitrap ID UNI11558

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55046969..55047210 238
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000010406 (Mrpl52) NM_026851 mitochondrial ribosomal protein L52 Gene [Source:MGI Symbol;Acc:MGI:1916086]

 
Come back to gene ENSMUSG00000010406


For any suggestions or comments, please send an email to unitrap@crg.es