Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D069G05
Clone ID D069G05
Vector rFROSAbgeo+1s
Project ggtc

Sequence tag D069G05
Sequence
CTCTTCAATCTGTTGGACTGCGTGCAGGAGGGGGGGTCCTTCTCCAAAGCCTTCAACTCCAACTATGAGCAGCGGACTGT
CCTCTGGCGAGCTGGCTTCAAGGGCAAGTCCAAACCCAATCTTCTCAAACAAGAAACCAGCAGCCTGGCCTGTTGTCTAA
GGATCCTGTTTAGAATGTACGTTGATGAGACCCGCAGGGATTCCTGGGACGAAATACAGCAGCGACTTCTAAG
Sequence Type mRNA
Unitrap ID UNI10411

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 166715844..166717405 138
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074582 (Arfgef2) NM_001085495 ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited) Gene [Source:MGI (curated);Acc:Arfgef2-001]


SPLK-Sequence tag 3SD069G05
Sequence
GCTTTTTATGCTGGCANTTACGGGACAGGAGCAATGG
Sequence Type genomic DNA
Unitrap ID UNI10411

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 166717468..166717504 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074582 (Arfgef2) NM_001085495 ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited) Gene [Source:MGI (curated);Acc:Arfgef2-001]

 
Come back to gene ENSMUSG00000074582


For any suggestions or comments, please send an email to unitrap@crg.es