Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D068F10
Clone ID D068F10
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD068F10
Sequence
GATCTGTGCCCAAGAGTTTGAGAGCAGTATGGGCAATGCAATGCAATACCTCCCCAAAAAAGAGTCCTTTGCCAATCCAG
CTTCAAAAGCCAGAGGAATTCCCTCAAAGGTCTCCTCCTCCCTCCCTCCCTGCTAGCCAAGCCTGGTTTCTATTAAGCTC
AATTATTCAAGCCCTCAGGGTACAACATAAACCCAGGCTTGTTTGGTTTGTTTTAGGTCTGGGGTACTGTTCCCCTTGGT
TGCACTTGAGTGTGACTTGAACCTCCTCATGAACTGTGGCCTCTGTCCTGTTGTTGAACCTCTGGCTTCTAGTCAGTGTT
ATTCAGAGCTGTAGACCCCCCACGTAGCCCTTGGACTGTCCCAGGGCCCAGTGATGACATGATTTGGTTCATGAACATGT
ACAGTACAGACCTTGTTTTATGGTCTGAGGTGGCCGGGCTTAGGATACTTCTTGGGAAGAAAAAGTAGGATTTTGGAT
Sequence Type genomic DNA
Unitrap ID UNI17236

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 59511908..59512385 478
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035168 (Tanc1) NM_198294 tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 Gene [Source:MGI (curated);Acc:Tanc1-001]


SPLK-Sequence tag 3SD068F10
Sequence
AACTTTGAAGTGTATTCAGTTTTGAAAGATAGTGGGGAGCAAAGATAAGCCCTAGTAATTCTATTCAACAGCAGTAAGGC
GTAT
Sequence Type genomic DNA
Unitrap ID UNI17236

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 59512407..59512490 84
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035168 (Tanc1) NM_198294 tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 Gene [Source:MGI (curated);Acc:Tanc1-001]

 
Come back to gene ENSMUSG00000035168


For any suggestions or comments, please send an email to unitrap@crg.es