Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D068F04
Clone ID D068F04
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD068F04
Sequence
TGTATCATTTTATAGTAATACTGCAACCCCCAGGGTAGAACTATTTAACCAAATAATTTTTTCCTTTTTTTGTGATATGC
CGAAGGCTACAATCTGCCTTTCTTTGAGTTGAGAAAGTAATAGGTAGTCATCTGTATGGAGAAAGTGACCTTTAGGCTCA
GAAACAGATCGCTCTCAGAGGCTCAGGGAAAAGAACCATGACAAGGAGCAGCTAAAGATAGAGGAGNNNCCTTTCCCTGG
GGTTAAGGAAAATTCAATGTTGTAGTCCCCTTTATAGTAGTATCATTCCACAAATGAGGTATAATAAAATCTA
Sequence Type genomic DNA
Unitrap ID UNI1536

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 108180294..108180605 291
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005698 (Ctcf) NM_007794 CCCTC-binding factor Gene [Source:MGI (curated);Acc:Ctcf-001]


SPLK-Sequence tag 3SD068F04
Sequence
AGATGGGAGAGGACAGAGATTTAAGCAATGAGGATTAAAGCAGGAGTCAAGAAGGGAGGAGATGGATTAAAACTGCTAAC
AGGGACAAGGCAGCTGGAGAGTATTCCCTCCAGGGAGTAAAGGAAAGAAGCCAGAGACTGTTGGGTTAGTTATTGATTCA
GAGGAGGGAATCACTTCTGGAGAAAAGCTAGACGAAGGAATGAATCTACTGCTCAAAGAGATGCACTGAGATTTCTAAGC
AGGGATAGGTTGCTTTTTCCTTTATGTGATGTTTCTCTAGAAGCTGTTGCTTTAAGACTTAAGTAGATGCTGATGTTCAT
GGATTTTAAGTCCTGTATTCCTTTCATTGAGTATTGTCAGCTCAACTCCTTGGCACACAATTGTTTTCGATTTGCATTCC
TTTATATGTTATTTTTTTTTCTACCTNNNATAATTCTGTGACTTCTTTTATATAGG
Sequence Type genomic DNA
Unitrap ID UNI1536

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 108180634..108181089 450
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005698 (Ctcf) NM_007794 CCCTC-binding factor Gene [Source:MGI (curated);Acc:Ctcf-001]

 
Come back to gene ENSMUSG00000005698


For any suggestions or comments, please send an email to unitrap@crg.es