Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D068F02
Clone ID D068F02
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD068F02
Sequence
GATCTCATTGCTCTGGGAGCTCCCTGTCCCTGGATGTGTCCCTGATGTCATTTTAGGCAGATTGCTGGCATCTCAGCACC
CCCCCCCATCCCCCTCAAGTGTCGCCTTCCTAGCCTGGCCAGCCATGCGCCATTTTGAGTGTTGTCAGCCTGGAGGGGAG
AGTTTGCTTGGTAACTGCACGGATGGAGTTTTGAGTCTTGGAGTTGCTTGTGTGGTNNNAAGCCTCCTAG
Sequence Type genomic DNA
Unitrap ID UNI14402

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 79268516..79268749 212
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022433 (Csnk1e) NM_013767 casein kinase 1, epsilon Gene [Source:MGI (curated);Acc:Csnk1e-001]

 
Come back to gene ENSMUSG00000022433


For any suggestions or comments, please send an email to unitrap@crg.es