Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D068E09
Clone ID D068E09
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD068E09
Sequence
GATCCTAGAGGAAGTTGTAATTGTAGTTTTTGCTTATGTATTGTTAAATTGCTCTTCTAACAGGTCACATAAATTATTAC
TTATATATGATTTTTACCAAAACTCTGTAACACTTGGGAGTATTA
Sequence Type genomic DNA
Unitrap ID UNI30237

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 88164229..88164353 125
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005621 (Zfp592) NM_178707 zinc finger protein 592 Gene [Source:MGI (curated);Acc:Zfp592-001]

 
Come back to gene ENSMUSG00000005621


For any suggestions or comments, please send an email to unitrap@crg.es