Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D068B10
Clone ID D068B10
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD068B10
Sequence
TCTCCGTGCTGATTCCCATGGCGGCGGAGCACGATTCGGACTCCGTTGAGCCTCCTGGTTCGGAGGCACTCCTGGACGCC
GTTCTGCGGACCCTCTACGACCTGGGTGAGCGTAGCTCCTGGGAGGAGGCGGCCAAAGACAGTGAAACGCATCCCGAGGC
GGCGGGACCACGGCCCACGTGGTCTCCTGGAGCCATGTCCGCAAGCGCTACCCTCTCCGGGACCTTCTCCCCCACTTGTT
GGCCGACCTTTTGCTCTCCTTCTCACTGTGCAGGAAAATAAAATCAGAGATGGTTACTAAAGGCAGGCCACTCGCAGAAG
GACAGGCACTGGCAGGCAGAAGAGCTCACGTTGATTGCCTGACTTTTAGAACCAGACAC
Sequence Type genomic DNA
Unitrap ID UNI12335

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 127386511..127386889 379
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031984 (2810004N23Rik) NM_025615 RIKEN cDNA 2810004N23 gene Gene [Source:MGI Symbol;Acc:MGI:1913773]


SPLK-Sequence tag 3SD068B10
Sequence
GCTGTATTGTTNNNATTTTGGAGCGGTTGCTCAAAATTCCAAGCTCACTTACACGATTAAAAAGCAAAAGCAAGCTGAGA
ACTTGGAAGAACGTACCAGGTGTACATGTACATGCATTTTTGTGTGTTTCCCTNNGTTAACTGTCAGAGCAACCCATATA
TGTACACACATCTTCATAAAGGTCCTCCTAAAGAGCTCGAGACTCTAGGTCTAGGGCATGATGTCACATTCTGCGCTGAG
TTAGGTTCTTTGTGTCCACCGACAACACTTGGCCTCCGACTTTCACAAGTTTGTTTGTTTGGG
Sequence Type genomic DNA
Unitrap ID UNI12335

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 127386200..127386501 279
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031984 (2810004N23Rik) NM_025615 RIKEN cDNA 2810004N23 gene Gene [Source:MGI Symbol;Acc:MGI:1913773]

 
Come back to gene ENSMUSG00000031984


For any suggestions or comments, please send an email to unitrap@crg.es