Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D068B04
Clone ID D068B04
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD068B04
Sequence
GACCAGCCTGGCTTGCTCTGTGGCTGACAGGGAGCCTGCTGCTGAACCAGCTTGTGCAAAGCTAAGAGCAAAGGGGCGGG
GGCGGGGGCAGACTGCTGCAAACCAGAGTGGGCCGGCTGCACACAGCCCAAGCTCCCCTCTGCACCTTTAGGCAGTGCAC
AGTTGCCCAGGGGCCAGTTTAGAGTCTTGCTTTAAGAGACCTTCCGCCGTTTCCCCTGATCTCTTTCCTCCTCAGACCCC
TCTGGTCTCACCTGTGCTCTGCTATGCCAGTCAGTGCCCTCCTTCCTCAGCGTCCCTCCTTGGTGTTTCATGGCCCTCCT
AGTCTCTGTCTTTTAGGTGGCACAGCATAAGTCAGTCAAGTACCTGCCATGTGTGGGTTTCAGGCTCTAATTTGCCCTCT
CATATTACCTCCCGGTTAGTCTTAAGGTAACAGGCCTTAGAGAGGCAGTGAGTGGCATGGATGACGGCCGAGGGGAAGGG
CATGGAAGTAGACTTCAGGAACTCAGTGAGGGTCATCATGATACCTTGGCAAGGCTTTGGACCCTGTTGTGCAAGGTTTC
CTGGAAGGACTGTTGTCTGAGTACAGCAGTGTGCTTCCTGGGCTGTGGGACCCAGGCTGGCGTGGACACTTACTCAGGC
Sequence Type genomic DNA
Unitrap ID UNI18413

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 116991023..116991661 639
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020823 (Sec14l1) NM_028777 SEC14-like 1 (S. cerevisiae) Gene [Source:MGI (curated);Acc:Sec14l1-007]


SPLK-Sequence tag 3SD068B04
Sequence
CATTGTGTGGGGAGTGTTAATCCCATTAGCAGCACTTGCGTACTACTGGGCAGGCGGTCTGCAGCAGGGGCATACTCCAG
AGAACACCTGGTCTGTATATTACGAATTTCTCTTTCTGTCATCCTTACCTTTAGGCTTACTTAACGGTGGGATATGCTAG
CTCCTTTGCCAAGCCTTGCCTGTCTTCATGTTATAAAGGAAATGCTTTGCTTGCAGGGCCTAGTGAAATGAGATGGTGTG
CCTTGTCTCTGTCTTCTGACTGAGAGAGGGCAGGGTGCTGGTGTTTAACAGCCCACTTCTTTTTTCATGGCTAGTGAACT
GCACATTAACAGCTTCCCGACCCGGCCTCATGAGTTTTGACTCTTACACTTTTAGTGTCCTGGGAGATGATTGCCATTGC
ATTTGGTGACCATGGGCTTTCTTGTGGTCCATTTTCAGAGAACTACAGAATGAAGTCCTTAGTTT
Sequence Type genomic DNA
Unitrap ID UNI18413

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 116991680..116992144 459
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020823 (Sec14l1) NM_028777 SEC14-like 1 (S. cerevisiae) Gene [Source:MGI (curated);Acc:Sec14l1-007]

 
Come back to gene ENSMUSG00000020823


For any suggestions or comments, please send an email to unitrap@crg.es