Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D068A12
Clone ID D068A12
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD068A12
Sequence
AAAACCGGGAAAAAAAAAGAGTATCTGCAACTTAATCTCAAATGGAAGGTAGGGCAGGATGGGAGAGAGGTAGAGGGGAC
AAGCCAGGAGCATAGATAATTATCACAGTAGACTTGCAACTTTTTACGTTTCAACTTTTTCCTAAATAAAGCTTTTTGCT
ATTTTTGAGGTAGGGCTTGACTGCAAACTTAGGGTCCTCTGTTTTGGTCTTTCTTAGCTTCCATAATCATGAATTACAGC
CATGTACTA
Sequence Type genomic DNA
Unitrap ID UNI3389

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 22358765..22359013 245
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021767 (Myst4) MYST histone acetyltransferase monocytic leukemia 4 Gene [Source:MGI Symbol;Acc:MGI:1858746]


SPLK-Sequence tag 3SD068A12
Sequence
AGGTATCAAACAAACCCAGACATCATGTGTGCTAAGTAAGCACTCTCCCAAGTGAGTTACGTCCTCTTTAAGTTGCCTTC
TAAAATTGGAAAGCCACCTACAGGCTTATCATAGAAGAAATCTCTGTAGTCATATCCTGCAGCCCTAAGGAAGTAAATGA
CAAGATAGCTGGGGTGGGTGACTGCTGTTGACTGTGTTGTCTTTCAGTGATTTTTCTCAATTACTCTGTGTCGGTTTTGT
AATCAGCAAATAGCGAATGGAGAGGTCACTTCTCTGTGCAAAATATATATTGTTTGTGCATTATTTTACATCAGTC
Sequence Type genomic DNA
Unitrap ID UNI3389

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 22359037..22359353 307
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021767 (Myst4) MYST histone acetyltransferase monocytic leukemia 4 Gene [Source:MGI Symbol;Acc:MGI:1858746]

 
Come back to gene ENSMUSG00000021767


For any suggestions or comments, please send an email to unitrap@crg.es