Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D067A08
Clone ID D067A08
Vector rFROSAbgeo+1s
Project ggtc

Sequence tag D067A08
Sequence
TCCTCNTTNAATCAATCGCAGGTCCGCCGCACGGGTATATGGGATGGAAGCGGGACCCTCGGGAGCAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD067A08
Sequence
CTGGTCTATGCTAGCCTTTCCCAGGGCCCCTTCTGTTCTGAATCGATCCTTTCTGCTGTCTGGACCCTCTGTGTGGAAAG
ATTTGTGGAGAATGGAAAGCGCTGTTTATTCCCCTTCTGACCTGCTGCCTCCCCTCTTAGTGCTCTTCCTCCTTCGAGAA
CCTCCAGCTTTCTTCCTCATGAGAGCTTTTCTTTCCTTCTGTTTCTTCATTCTACATCTAGAGAGTTTTTTCCCTGTACC
CCAATCCAACTTACCTTGCCTTATCTGCACCCTTTCCCCCACCCCCTTCGTGTGTGTTTTCTCTTGTGCCCTCCAG
Sequence Type genomic DNA
Unitrap ID UNI10652

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 126141728..126142044 293
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041530 (Eif2c1) NM_153403 eukaryotic translation initiation factor 2C, 1 Gene [Source:MGI (curated);Acc:Eif2c1-001]

 
Come back to gene ENSMUSG00000041530


For any suggestions or comments, please send an email to unitrap@crg.es