Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D067A02
Clone ID D067A02
Vector rFROSAbgeo+1s
Project ggtc

Sequence tag D067A02
Sequence
AAAATTTTAGCGCGCGCGGCGTGTGGCTCCTGTTGTCCTCGCCAGTTTCAGCTCAGCACACGGGCCAGCCTTTCGCTGGT
TTGGAGTTCCNNNNCTCCGGGTTCCTGACCCCGCGCCCCATTCCCGTGTCCCCAGTTCCCGGTTCCAGGAATGCCTCGTG
CTCGGAAGGGCAATGCGCTCCGCAAGGGCGGTCAGCGCCGTGGAGGAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SD067A02
Sequence
TCCTGTCGTCCTCGCCAGTCTCAGCTCAGCACACGGGCCAGCGTTTCGCTGGTTTGGAGTCCCCGGCCTCCGGGTCCCTG
ACCCCGCGCCCCATTCCCGTGTCCCCAGTTCCCGGTTCCAGGAATGCCTCGTGCTCGGAAGGGCAATGCGCTCCGCAAGG
GCGGTCAGCGCCGTGGAGGAGGTGAGTCCGGGGGCTCCAGTAGACTTGTTCAGTAGTGAGCGGGGGTGTTCCGTGATTCC
CCTTCGATGTCATTGAGGGACCTGAGTTGATGAATCTTCCCAGATCAGCCCAGCCTGACCTCCCAGAACTCTGCTAAGGC
TCGCACGTGCCCCAGCTGGCATTGGCCACGTGTGCGCCTCACTTGAGCACATTGCCAGCTGTTTTTCGAAATCCCGCGCC
GCAACGATGATTTGACCAGCATTAAGGACCTAGGTTTTCCCATCGCTACTGGGGTAGAAAACCACACCAGAAAGAGCGTG
AAGCCAACCCTTTTGCCAAATACTAGTAGTGCATTTGGTAGGCTGCACAAGGAAATTAGTAGAGAGACCTTGTCTGTTCG
GTAAAACGGGGAAGTGTGATTGG
Sequence Type genomic DNA
Unitrap ID UNI5891

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 107490097..107490679 567
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000010048 (Ifrd2) NM_025903 interferon-related developmental regulator 2 Gene [Source:MGI Symbol;Acc:MGI:1316708]


SPLK-Sequence tag 3SD067A02
Sequence
GGGGCCTATCAATTGGACTAGAGACCGGGNNGCATCCAGAGAGCCCGAAGCAGCCTGGAGACTTCTTATCAGACTCAACC
AGAAGCATGACCTGTTGCATTAAACAAACAACTGCTGAAAAAGAGTGCCTGCCCAGCATATTTTTGACCTGACAGCCACT
TTAATGTGGCTTGGGTCTCGGGGCATTTAATAGGGTGGTGACAGTTCCACAAGAACTAGTACTGAAAGCATATACTTACC
GAGAGTGGTCTTAGAATCATGGCAGGCCCTGTGAGGGGAGCTTCTGAGACGGTAAAGAACCTGGCGCAAGGGCCCAGCAG
CCAAAGGGACCACAATACAGTGCGGCAGATGAGACCGTCCGGGCGGTTTTGACAAGTAGGATAGTAAGAGAAGAGGTGAA
CAGAAATCAACGTGTGGGCTGAACGTTTTTTTACAAGCAAGTAATGTTAGTGGTCCCTAAGGTGTAAGGACTCCTACTGG
GTCAGAACCTGTCCAGGGTGCCTACCATAGTAGCTGCCCTATTTAAGGCCAGTCTTCAGCCCTGGAGAGAGTTCACAGGC
CGTCTCTCTGTTCCTGCCCTACTGACACTTTGAGAGTCCCTATGTTTACTTTTT
Sequence Type genomic DNA
Unitrap ID UNI5891

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 107490695..107491309 593
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000010048 (Ifrd2) NM_025903 interferon-related developmental regulator 2 Gene [Source:MGI Symbol;Acc:MGI:1316708]

 
Come back to gene ENSMUSG00000010048


For any suggestions or comments, please send an email to unitrap@crg.es