Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D065H06
Clone ID D065H06
Vector rFROSAbgeo+1s
Project ggtc

Sequence tag D065H06
Sequence
AGTTCTTTTTTCCCCCTTCCCGAGGAAGCTCACATGGACAGAGCCGCATAATCAGAAAGGCTTATCCAGATGACTTCTAC
ACGATGATGAAGAAGGAATGCTATGAGGACATGGGTNNNTCTGNNGCGAGAAGCCGATACCCATTTACACAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SD065H06
Sequence
GATCCTGTGACCAAGGCTCTTACAGGTTGTTTTCTGAAAACTTAGAGGATGACCATGGACAGGTATCTAGAGCAGGCCTG
CGCAAAGCCTTCCAGAGCCATCTTATAGGGCCTGCGTCAAAATCTATATAA
Sequence Type genomic DNA
Unitrap ID UNI13754

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77705285..77705415 131
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017453 (Pipox) NM_008952 pipecolic acid oxidase Gene [Source:MGI (curated);Acc:Pipox-001]


SPLK-Sequence tag 3SD065H06
Sequence
CGTCTCTCCTGCCTCCTTTTTATGCTGTACCCTCATCCCCACAACAACCCTACAAATGCATTTTATTAATACACTATCCC
CTGGGAACAAAAGCAGGTGTTCCAGGGGCCAGACTACTTGCCAGGAAGTGACCCTGAAGCAGCTTCAAACCTTAGGGATC
CTCTGACAGTGGCCTTTCTGACACTCTCAGGGAGGAACCAGAAACTACTCCTGCACCCCCTTTTACTCCTCTGAACTCTT
AACTGAACCTCCTTTACATAACCCTGGATCTGCCGCACAGGTTGGCAGTTATTTTAATGGCCGAGAACCAAGAGGTTACT
GTTCTGTTACGAAAACACCATTAACTTAAGAGCGAAGAGCAATCCTTTATGCTAATACCGCCAGGGCAGCTAATTNTNNG
NTTATTCAGAGACAGCTAGTNNNNCCAGCACCGCAATATAGGAGAATGACTTTCTGAGGAGTGTCCTGGCAGAAGGGACC
CTTCTCTGGCTGCTGGCTGTGAGTACTACGGAGCTCTATGAGGTAGGAGATGAGCTGAGACTTGAAGNNNNNNAGTCTGC
CCAGCAAATGTTGACCGACAGGCAATCATGAGATGCCCTGGTGTCACACAGTTTGGGCTTTACTTCCTGACTCAACTCCT
ACCAGCTATGTGGGTGAACTCTCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000017453


For any suggestions or comments, please send an email to unitrap@crg.es